On-target is the proportion of detected RI reference genomes assigned to the target; RI genome sensitivity is the proportion of target RI reference genomes detected.
Primer Species LP RP Tml Tmr Length Score ⇅ On-target ⇅ RI genome sensitivity ⇅
Primer 201 Campylobacter jejuni GCTCAAGGCGTTTTGGAAGA GGCTCTCCGTTGGCAGTAA 59.05 59.70 214 27
100.00% Complete
100.00%
75.00% Complete
75.00%